NCERT Solutions for Class 12 Biology Part 2

Categories: NCERT Solutions Science Intermediate class

NCERT Solutions for Class 12 Biology Part 2

Molecular Basis of Inheritance Class 12

 

Q1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.

Answer: Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine. Nucleosides present in the list are cytidine and guanosine.

 

Q2: Mention any two autosomal genetic disorders with their symptoms.

Answer: Two autosomal genetic disorders are as follows.

1. Sickle cell Anaemia 

It is an autosomal linked recessive disorder, which is caused by point mutation in the beta-globin chain of haemoglobin pigment of the blood. The disease is characterized by sickle shaped red blood cells, which are formed due to the mutant haemoglobin molecule. The disease is controlled by Hb

A and Hb

S allele. The homozygous

individuals with genotype, Hb

SHb

S

, show the symptoms of this disease while the heterozygous individuals with

genotype, Hb A Hb S

, are not affected. However, they act as carriers of the disease.

Symptoms

Rapid heart rate, breathlessness, delayed growth and puberty, jaundice, weakness, fever, excessive thirst, chest pain, and decreased fertility are the major symptoms of sickle cell anaemia disease.

(b) Down's syndrome

It is an autosomal disorder that is caused by the trisomy of chromosome 21. Symptoms The individual is short statured with round head, open mouth, protruding tongue, short neck, slanting eyes, and broad short hands. The individual also shows retarded mental and physical growth.

 

Q3: If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Answer: According to Chargaff's rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.

% A = % T and % G = % C

If dsDNA has 20% of cytosine, then according to the law, it would have 20% of guanine. Thus, percentage of G + C content = 40% The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%.

 

Q4: If the sequence of one strand of DNA is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write down the sequence of complementary strand in 5' → 3' direction

 

Answer: The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one

strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC - 3'

Then, the sequence of complementary strand in direction will be

3'- TACGTACGTACGTACGTACGTACGTACG - 5'

Therefore, the sequence of nucleotides on DNA polypeptide in direction is

5'- GCATGCATGCATGCATGCATGCATGCAT - 3'

 

Q5: If the sequence of the coding strand in a transcription unit is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write down the sequence of mRNA.

Answer: If the coding strand in a transcription unit is

5'- ATGCATGCATGCATGCATGCATGCATGC-3'

Then, the template strand in 3' to 5' direction would be

3' - TACGTACGTACGTACGTACGTACGTACG-5'

It is known that the sequence of mRNA is same as the coding strand of DNA.

However, in RNA, thymine is replaced by uracil.

Hence, the sequence of mRNA will be

5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'

 

Q6: Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Answer: Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesized daughter strand. Since only one parental strand is conserved in each daughter molecule, it is known as the semi-conservative mode of replication.

 

Q7: Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.

Answer: There are two different types of nucleic acid polymerases.

(1) DNA-dependent DNA polymerases

(2) DNA-dependent RNA polymerases

The DNA-dependent DNA polymerases use a DNA template for synthesizing a new strand of DNA, whereas DNA-dependent RNA polymerases use a DNA template strand for synthesizing RNA.

 

Q8: How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?

Answer: Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage. They grew some bacteriophages on a medium containing radioactive phosphorus (32P) to identify DNA and some on a medium containing radioactive sulphur (35S) to identify protein. Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated from the bacterial cell by blending and then subjected to the process of centrifugation.

Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.

Q8: List two essential roles of ribosome during translation.

Answer: The important functions of ribosome during translation are as follows.

(a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits. 

The smaller subunit comes in contact with mRNA and forms a protein synthesizing complex whereas the larger subunit acts as an amino acid binding site.

(b) Ribosome acts as a catalyst for forming peptide bond. For example, 23s r-RNA in bacteria acts as a ribozyme.

 

Q9: In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?

Answer: Lac operon is a segment of DNA that is made up of three adjacent structural genes, namely, an operator gene, a promoter gene, and a regulator gene. It works in a coordinated manner to metabolize lactose into glucose and galactose. In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it. Once the lactose binds to the repressor, RNA polymerase binds to the promoter region. Hence, three structural genes express their product and respective enzymes are produced. These enzymes act on lactose so that lactose is metabolized into glucose and galactose.

After sometime, when the level of inducer decreases as it is completely metabolized by enzymes, it causes synthesis of the repressor from regulator gene. The repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped. This type of regulation is known as negative regulation.

 

Q10: Explain (in one or two lines) the function of the followings:

(a) Promoter

(b) tRNA

(c) Exons

Answer:

(a) Promoter

A promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase.

(b) tRNA

tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acid to mRNA on ribosome during translation of proteins.

(c) Exons

Exons are coding sequences of DNA in eukaryotes that transcribe for proteins.

Top Blogs
Sequence and Series : An important topic from the examination perspective Published at:- NCERT Solutions for Class 12 Chemistry Part 1 Published at:- NCERT Solutions for Class 12 Chemistry Part 2 Published at:- NCERT Solutions for Class 12 Chemistry Part 3 Published at:- NCERT Solutions for Class 12 Chemistry Part 1 Electrochemistry Published at:- NCERT Solutions for Class 12 Biology Chapter 1 Published at:- NCERT Solutions for Class 12 Biology Part 2 Published at:- NCERT Solutions for Class 12 Biology Part 2 Published at:- NCERT Solutions for Class 12 Biology Published at:- NCERT Solutions for Class 12 Biology Ecosystem Published at:- NCERT Solutions for Class 12 Biology Environmental Issues Published at:- NCERT Solutions for Class 12 English Flamingo Published at:- NCERT Solutions for Class 12 English Flamingo The Last Lesson Class Published at:- NCERT Solutions for Class 12 English Lost Spring Published at:- NCERT Solutions for Class 12 English Lost Spring (Part 2) Published at:- NCERT Solutions for Class 12 English Deep Water Published at:- NCERT Solutions for Class 12 English The Rattrap Published at:- NCERT Solutions for Class 12 English The Rattrap (Set 2) Published at:- NCERT Solutions for Class 12 English Indigo Published at:- NCERT Solutions for Class 12 English Indigo (set 2) Published at:- NCERT Solutions for Class 12 English Third level Published at:- NCERT Solutions for Class 12 Business Studies Business Finance and Marketing Published at:- NCERT Solutions for Class 12 Business Studies Business Finance and Marketing Published at:- NCERT Solutions for Class 11 Accountancy Financial Accounting Published at:- NCERT Solutions for Class 11 Accountancy Financial Accounting part 2 Published at:- History Of Accountancy Published at:-
R4R.co.in Team
The content on R4R is created by expert teams.